Red Cotton™ gRNA Plasmid Bank | Ubigene

location: Home > Products >
All products
  • All products
  • Red Cotton™ gRNA Plasmid Bank
  • KO Cell Lines
  • Wild-type Cell Lines
  • Cas9 Stable Cell Lines
  • Luciferase Stable Cell Lines
  • EGFP Stable Cell Lines
  • Stem Cell Lines
  • Transfection Culture Medium
  • Cell Monoclonal Culture Medium
  • EZ-Stem Cell Culture Medium
  • Kits
  • Lentivirus

Red Cotton™ gRNA Plasmid Bank

Based on our CRISPR-U™ Technology and thousands of gene-editing success cases, Ubigene has successfully developed a series of gRNA plasmids (YKO) with high gene-editing efficiency, including regular plasmids, lentiviral plasmids, and AAV plasmids. And Ubigene has successfully established the Red Cotton™ gRNA Plasmid Bank, which is the basis of our “Red Cotton Gene Knockout Project”. Ubigene's plasmids can enter cells via regular transfection methods and can edit target sites efficiently after transient expression of high levels of Cas9 protein in target cells. Also, our plasmids can be co-transfected with a variety of gRNAs to target multiple sites in cells. At present, our Red Cotton™ gRNA Plasmid Bank has over 10000 gRNA plasmids in stock, which can be widely used in different fields of gene-editing research. You can search our in-stock gRNA plasmids according to your gene of interest.

Gene ID Size Price (USD) Turnaround Resistance Instruction Product Name Type of Plasmid Catalog# gRNA Sequence
   10024 ≥2ug 80 3-5(business day) EGFP/puro/cas9
hTROAP gRNA1 KO plasmid
hTROAP gRNA2 KO plasmid
hTROAP gRNA3 KO plasmid
Regular Plasmid YKO-RP003-hTROAP[gRNA1]
YKO-RP003-hTROAP[gRNA2]
YKO-RP003-hTROAP[gRNA3]
CACTGTTACATCGTGCGCCGTGG(99,0.73)
GCGTACCGGAATCTTGCTAGGGG(98,0.67)
ATCCTTCGTGGCTTGCCGGGTGG(92,0.76)
   10026 ≥2ug 80 3-5(business day) EGFP/puro/cas9
hPIGK gRNA1 KO plasmid
hPIGK gRNA2 KO plasmid
hPIGK gRNA3 KO plasmid
Regular Plasmid YKO-RP003-hPIGK[gRNA1]
YKO-RP003-hPIGK[gRNA2]
YKO-RP003-hPIGK[gRNA3]
ACTAGCGGCCACGCTGCCGA AGG(97,0.76)
CAGCCGGGCTGCGACTGTCT TGG(91,0.73)
CTGTTTATAGAAGTGTCAAG AGG(63,0.69)
   10038 ≥2ug 80 3-5(business day) EGFP/puro/cas9
hPARP2 gRNA1 KO plasmid
hPARP2 gRNA2 KO plasmid
hPARP2 gRNA3 KO plasmid
Regular Plasmid YKO-RP003-hPARP2[gRNA1]
YKO-RP003-hPARP2[gRNA2]
YKO-RP003-hPARP2[gRNA3]
GGAGTCGAAAAAGATGCCTG TGG(73,0.85)
GAAGGTCATGGGCCAGCAAA AGG(70,0.69)
GGCTGGAGGAAAAGCTAATA AGG(72,0.6)
   10039 ≥2ug 80 3-5(business day) EGFP/puro/cas9
hPARP3 gRNA1 KO plasmid
hPARP3 gRNA2 KO plasmid
hPARP3 gRNA3 KO plasmid
Regular Plasmid YKO-RP003-hPARP3[gRNA1]
YKO-RP003-hPARP3[gRNA2]
YKO-RP003-hPARP3[gRNA3]
AGAGAAGCGCATAATCCGCGTGG(98,0.71)
CCTCAGCGGTGGAGCGGAAGGGG(77,0.73)
AGGGCCCTCAGTCTGTACCCAGG(76,0.68)
   10053 ≥2ug 80 3-5(business day) EGFP/puro/cas9
hAP1M2 gRNA1 KO plasmid
hAP1M2 gRNA2 KO plasmid
hAP1M2 gRNA3 KO plasmid
Regular Plasmid YKO-RP003-hAP1M2[gRNA1]
YKO-RP003-hAP1M2[gRNA2]
YKO-RP003-hAP1M2[gRNA3]
TTGTAGTTGCGGCTGATCAATGG(92,0.67)
ACGGCCAGGTCCACTTCCTATGG(82,0.68)
TTTGCTGGTACAGCGGGAGGAGG(79,0.76)
   10062 ≥2ug 80 3-5(business day) EGFP/puro/cas9
hNR1H3 gRNA1 KO plasmid
hNR1H3 gRNA2 KO plasmid
hNR1H3 gRNA3 KO plasmid
Regular Plasmid YKO-RP003-hNR1H3[gRNA1]
YKO-RP003-hNR1H3[gRNA2]
YKO-RP003-hNR1H3[gRNA3]
ACTCTGCTGGGGGTACTGCA GGG(72,0.73)
CTGCTTGCATCCTGTGCGCC TGG(74,0.6)
TTCTGAAGGGGGCTCTGCCC TGG(66,0.74)
   10066 ≥2ug 80 3-5(business day) EGFP/puro/cas9
hSCAMP2 gRNA1 KO plasmid
hSCAMP2 gRNA2 KO plasmid
hSCAMP2 gRNA3 KO plasmid
Regular Plasmid YKO-RP003-hSCAMP2[gRNA1]
YKO-RP003-hSCAMP2[gRNA2]
YKO-RP003-hSCAMP2[gRNA3]
CCAGCTGACCAACGCCCCGCAGG(93,0.67)
AGAAGGGGTTGAATTCCGCCAGG(81,0.72)
ACCGCTGGCTGTGAGGACCCAGG(61,0.68)
   10084 ≥2ug 80 3-5(business day) EGFP/puro/cas9
hPQBP1 gRNA1 KO plasmid
hPQBP1 gRNA2 KO plasmid
hPQBP1 gRNA3 KO plasmid
Regular Plasmid YKO-RP003-hPQBP1[gRNA1]
YKO-RP003-hPQBP1[gRNA2]
YKO-RP003-hPQBP1[gRNA3]
CTGGTGGCCTCGTAGTCCACAGG(87,0.81)
AGAGGAAGAGATCATTGCCGAGG(82,0.83)
TGGAGGGCCTACCACCAAGCTGG(82,0.68)
   10087 ≥2ug 80 3-5(business day) EGFP/puro/cas9
hCERT1 gRNA1 KO plasmid
hCERT1 gRNA2 KO plasmid
Regular Plasmid YKO-RP003-hCERT1[gRNA1]
YKO-RP003-hCERT1[gRNA2]
GAGCTGGAACTCGTCGGGCT CGG(94,0.71)
GCCGCCTGTGGAGCGCTGCG GGG(86,0.73)
   10105 ≥2ug 80 3-5(business day) EGFP/puro/cas9
hPPIF gRNA1 KO plasmid
hPPIF gRNA2 KO plasmid
hPPIF gRNA3 KO plasmid
Regular Plasmid YKO-RP003-hPPIF[gRNA1]
YKO-RP003-hPPIF[gRNA2]
YKO-RP003-hPPIF[gRNA3]
AGGCGCAGCGGCACGGAGCG CGG(80,0.78)
TTGCTGCAGGCGCGGGCCGC GGG(77,0.75)
GGAGGAAGAGGACGGGTCGC CGG(71,0.74)

Contact us