Red Cotton™ gRNA Plasmid Bank | Ubigene

location: Home > Products >
All products
  • All products
  • Red Cotton™ gRNA Plasmid Bank
  • KO Cell Lines
  • Wild-type Cell Lines
  • Cas9 Stable Cell Lines
  • Luciferase Stable Cell Lines
  • EGFP Stable Cell Lines
  • Stem Cell Lines
  • Transfection Culture Medium
  • Cell Monoclonal Culture Medium
  • EZ-Stem Cell Culture Medium
  • Kits
  • Lentivirus

Red Cotton™ gRNA Plasmid Bank

Based on our CRISPR-U™ Technology and thousands of gene-editing success cases, Ubigene has successfully developed a series of gRNA plasmids (YKO) with high gene-editing efficiency, including regular plasmids, lentiviral plasmids, and AAV plasmids. And Ubigene has successfully established the Red Cotton™ gRNA Plasmid Bank, which is the basis of our “Red Cotton Gene Knockout Project”. Ubigene's plasmids can enter cells via regular transfection methods and can edit target sites efficiently after transient expression of high levels of Cas9 protein in target cells. Also, our plasmids can be co-transfected with a variety of gRNAs to target multiple sites in cells. At present, our Red Cotton™ gRNA Plasmid Bank has over 10000 gRNA plasmids in stock, which can be widely used in different fields of gene-editing research. You can search our in-stock gRNA plasmids according to your gene of interest.

Gene ID Size Price (USD) Turnaround Resistance Instruction Product Name Type of Plasmid Catalog# gRNA Sequence
   10106 ≥2ug 80 3-5(business day) EGFP/puro/cas9
hCTDSP2 gRNA1 KO plasmid
hCTDSP2 gRNA2 KO plasmid
hCTDSP2 gRNA3 KO plasmid
Regular Plasmid YKO-RP003-hCTDSP2[gRNA1]
YKO-RP003-hCTDSP2[gRNA2]
YKO-RP003-hCTDSP2[gRNA3]
CCTCCGCGCCTGGGTGATGA TGG(64,0.74)
TCCACGAGGCTTCTTAGGAG AGG(85,0.66)
GGGCGCGAAAACAGCAGAAA AGG(68,0.6)
   10112 ≥2ug 80 3-5(business day) EGFP/puro/cas9
hKIF20A gRNA1 KO plasmid
hKIF20A gRNA2 KO plasmid
hKIF20A gRNA3 KO plasmid
Regular Plasmid YKO-RP003-hKIF20A[gRNA1]
YKO-RP003-hKIF20A[gRNA2]
YKO-RP003-hKIF20A[gRNA3]
TCATCGGACAGCAAGCCCGCTGG(94,0.68)
CGACAGAGCAGTCTGATAGCAGG(84,0.68)
TGCAGCTGTGGACTCAAACATGG(71,0.67)
   10130 ≥2ug 80 3-5(business day) EGFP/puro/cas9
hPDIA6 gRNA1 KO plasmid
hPDIA6 gRNA2 KO plasmid
Regular Plasmid YKO-RP003-hPDIA6[gRNA1]
YKO-RP003-hPDIA6[gRNA2]
TTCGATCACATCATCACTAGAGG(90,0.71)
ACTTCTCGGTTGAAATTCGATGG(95,0.6)
   10134 ≥2ug 80 3-5(business day) EGFP/puro/cas9
hBCAP31 gRNA1 KO plasmid
hBCAP31 gRNA2 KO plasmid
hBCAP31 gRNA3 KO plasmid
Regular Plasmid YKO-RP003-hBCAP31[gRNA1]
YKO-RP003-hBCAP31[gRNA2]
YKO-RP003-hBCAP31[gRNA3]
CCTTTCAGTTAAACGGGCGT CGG(97,0.71)
GGACGTGTTGACACACGTGC TGG(90,0.68)
ATCGTCGGGAGAGGCCGCTC TGG(89,0.71)
   10147 ≥2ug 80 3-5(business day) EGFP/puro/cas9
hSUGP2 gRNA1 KO plasmid
hSUGP2 gRNA2 KO plasmid
hSUGP2 gRNA3 KO plasmid
Regular Plasmid YKO-RP003-hSUGP2[gRNA1]
YKO-RP003-hSUGP2[gRNA2]
YKO-RP003-hSUGP2[gRNA3]
GACTGGAAATTTGCGCTCCG TGG(97,0.74)
TATGATGACGTCCACAGCGA TGG(94,0.71)
GGTCATTGGCCACCGGAAAT TGG(94,0.69)
   10148 ≥2ug 80 3-5(business day) EGFP/puro/cas9
hEBI3 gRNA1 KO plasmid
hEBI3 gRNA2 KO plasmid
hEBI3 gRNA3 KO plasmid
Regular Plasmid YKO-RP003-hEBI3[gRNA1]
YKO-RP003-hEBI3[gRNA2]
YKO-RP003-hEBI3[gRNA3]
CACGGCGATCGGGTACCGAG AGG(98,0.74)
NA (NA,NA)
NA (NA,NA)
   10155 ≥2ug 80 3-5(business day) EGFP/puro/cas9
hTRIM28 gRNA1 KO plasmid
hTRIM28 gRNA2 KO plasmid
hTRIM28 gRNA3 KO plasmid
Regular Plasmid YKO-RP003-hTRIM28[gRNA1]
YKO-RP003-hTRIM28[gRNA2]
YKO-RP003-hTRIM28[gRNA3]
GGAGCGCTTTTCGCCGCCAGCGG(97,0.8)
GAGAGCGCCTGCGACCCGAGAGG(90,0.74)
CCCCGCGGGCGACGACGCCGCGG(86,0.73)
   10162 ≥2ug 80 3-5(business day) EGFP/puro/cas9
hLPCAT3 gRNA1 KO plasmid
hLPCAT3 gRNA2 KO plasmid
hLPCAT3 gRNA3 KO plasmid
Regular Plasmid YKO-RP003-hLPCAT3[gRNA1]
YKO-RP003-hLPCAT3[gRNA2]
YKO-RP003-hLPCAT3[gRNA3]
GGCCTGTAAAGGTATGGAAG AGG(78,0.78)
GGTAGGTCTCCTTGTAGAAA AGG(64,0.62)
NA (NA,NA)
   10163 ≥2ug 80 3-5(business day) EGFP/puro/cas9
hWASF2 gRNA1 KO plasmid Regular Plasmid YKO-RP003-hWASF2[gRNA1] TGAGAGGGTCGACCGACTACAGG(99,0.78)
   10165 ≥2ug 80 3-5(business day) EGFP/puro/cas9
hSLC25A13 gRNA1 KO plasmid
hSLC25A13 gRNA2 KO plasmid
hSLC25A13 gRNA3 KO plasmid
Regular Plasmid YKO-RP003-hSLC25A13[gRNA1]
YKO-RP003-hSLC25A13[gRNA2]
YKO-RP003-hSLC25A13[gRNA3]
TCGAGTGACAAAGTCATTGGGGG(81,0.76)
CCACAGTCTTTGGATTAGGCTGG(68,0.7)
TTTCAGCTGTTTGACAAAGCTGG(69,0.67)

Contact us