Red Cotton™ gRNA Plasmid Bank | Ubigene

location: Home > Products >
All products
  • All products
  • Red Cotton™ gRNA Plasmid Bank
  • KO Cell Lines
  • Wild-type Cell Lines
  • Cas9 Stable Cell Lines
  • Luciferase Stable Cell Lines
  • EGFP Stable Cell Lines
  • Stem Cell Lines
  • Transfection Culture Medium
  • Cell Monoclonal Culture Medium
  • EZ-Stem Cell Culture Medium
  • Kits
  • Lentivirus

Red Cotton™ gRNA Plasmid Bank

Based on our CRISPR-U™ Technology and thousands of gene-editing success cases, Ubigene has successfully developed a series of gRNA plasmids (YKO) with high gene-editing efficiency, including regular plasmids, lentiviral plasmids, and AAV plasmids. And Ubigene has successfully established the Red Cotton™ gRNA Plasmid Bank, which is the basis of our “Red Cotton Gene Knockout Project”. Ubigene's plasmids can enter cells via regular transfection methods and can edit target sites efficiently after transient expression of high levels of Cas9 protein in target cells. Also, our plasmids can be co-transfected with a variety of gRNAs to target multiple sites in cells. At present, our Red Cotton™ gRNA Plasmid Bank has over 10000 gRNA plasmids in stock, which can be widely used in different fields of gene-editing research. You can search our in-stock gRNA plasmids according to your gene of interest.

Gene ID Size Price (USD) Turnaround Resistance Instruction Product Name Type of Plasmid Catalog# gRNA Sequence
   10211 ≥2ug 80 3-5(business day) EGFP/puro/cas9
hFLOT1 gRNA1 KO plasmid
hFLOT1 gRNA2 KO plasmid
hFLOT1 gRNA3 KO plasmid
Regular Plasmid YKO-RP003-hFLOT1[gRNA1]
YKO-RP003-hFLOT1[gRNA2]
YKO-RP003-hFLOT1[gRNA3]
CCGAAGCCCCCCAGTCATGG TGG(65,0.65)
AAAAGGTTTACACTCGCCAT GGG(94,0.76)
NA (NA,NA)
   10217 ≥2ug 80 3-5(business day) EGFP/puro/cas9
hCTDSPL gRNA1 KO plasmid
hCTDSPL gRNA2 KO plasmid
hCTDSPL gRNA3 KO plasmid
Regular Plasmid YKO-RP003-hCTDSPL[gRNA1]
YKO-RP003-hCTDSPL[gRNA2]
YKO-RP003-hCTDSPL[gRNA3]
TCTCGCCCGCGCCCGGCAACCGG(89,0.79)
ACCAACCCCAAGGAGGACGAGGG(82,0.65)
CGGCCCGGCCATCATCACCCAGG(79,0.69)
   10232 ≥2ug 80 3-5(business day) EGFP/puro/cas9
hMSLN gRNA1 KO plasmid
hMSLN gRNA2 KO plasmid
hMSLN gRNA3 KO plasmid
Regular Plasmid YKO-RP003-hMSLN[gRNA1]
YKO-RP003-hMSLN[gRNA2]
YKO-RP003-hMSLN[gRNA3]
AGGCCGGACACCTCCGCACACGG(91,0.65)
GGAAGCCAAGGAGTTGGCGAGGG(77,0.76)
CACGGAGCGTGTCCGGGAGCTGG(75,0.7)
   10236 ≥2ug 80 3-5(business day) EGFP/puro/cas9
hHNRNPR gRNA1 KO plasmid
hHNRNPR gRNA2 KO plasmid
hHNRNPR gRNA3 KO plasmid
Regular Plasmid YKO-RP003-hHNRNPR[gRNA1]
YKO-RP003-hHNRNPR[gRNA2]
YKO-RP003-hHNRNPR[gRNA3]
TGCGGTACAGTTAAAAGAAGAGG(74,0.65)
ACACTACAAGACACTGATAGAGG(67,0.82)
GTTACACTGGAAGTATCCATTGG(69,0.6)
   1024 ≥2ug 80 3-5(business day) EGFP/puro/cas9
hCDK8 gRNA1 KO plasmid
hCDK8 gRNA2 KO plasmid
Regular Plasmid YKO-RP003-hCDK8[gRNA1]
YKO-RP003-hCDK8[gRNA2]
CAGCGAGCGGGAGCGGGTCG AGG(81,0.87)
GAGGGCTGCAAAGTTGGCCG AGG(80,0.84)
   10244 ≥2ug 80 3-5(business day) EGFP/puro/cas9
hRABEPK gRNA1 KO plasmid Regular Plasmid YKO-RP003-hRABEPK[gRNA1] GCTGTCTCCAGGGACAGTCAAGG(62,0.82)
   1026 ≥2ug 80 3-5(business day) EGFP/puro/cas9
hCDKN1A gRNA1 KO plasmid
hCDKN1A gRNA2 KO plasmid
hCDKN1A gRNA3 KO plasmid
Regular Plasmid YKO-RP003-hCDKN1A[gRNA1]
YKO-RP003-hCDKN1A[gRNA2]
YKO-RP003-hCDKN1A[gRNA3]
CGCTGTCCACTGGGCCGAAG AGG(88,0.67)
TTCTGACGGACATCCCCAGC CGG(83,0.66)
CGGCAGGCCTTGCTGCCGCA TGG(78,0.69)
   10269 ≥2ug 80 3-5(business day) EGFP/puro/cas9
hZMPSTE24 gRNA1 KO plasmid
hZMPSTE24 gRNA2 KO plasmid
Regular Plasmid YKO-RP003-hZMPSTE24[gRNA1]
YKO-RP003-hZMPSTE24[gRNA2]
CTCCCAAAGATACACTGTCCAGG(73,0.67)
GGACGCTTTGTGGGAGATGCCGG(70,0.66)
   1027 ≥2ug 80 3-5(business day) EGFP/puro/cas9
hCDKN1B gRNA1 KO plasmid
hCDKN1B gRNA2 KO plasmid
hCDKN1B gRNA3 KO plasmid
Regular Plasmid YKO-RP003-hCDKN1B[gRNA1]
YKO-RP003-hCDKN1B[gRNA2]
YKO-RP003-hCDKN1B[gRNA3]
TCAAACGTGCGAGTGTCTAACGG(96,0.69)
CAGGAACCTCTTCGGCCCGGTGG(91,0.65)
GCCTGGCGTCCATCCGCTCCAGG(79,0.74)
   10280 ≥2ug 80 3-5(business day) EGFP/puro/cas9
hSIGMAR1 gRNA1 KO plasmid
hSIGMAR1 gRNA2 KO plasmid
hSIGMAR1 gRNA3 KO plasmid
Regular Plasmid YKO-RP003-hSIGMAR1[gRNA1]
YKO-RP003-hSIGMAR1[gRNA2]
YKO-RP003-hSIGMAR1[gRNA3]
GCCGAAGAGCAGCACATACT CGG(79,0.65)
CGAGGCGTGCAGAAGGCACA TGG(67,0.78)
GTGGCCGCGGGAGCCCAAGG CGG(63,0.76)

Contact us