standard

Due to the implementation of the human genome project and the rapid development of molecular biology and bioinformatics, the concepts of "precision medicine", "personalized medicine" and "targeted therapy" have been widely recognized in the clinic, and the concept of Companion diagnostics is gradually known to the public. At present, many diseases have confirmed the existence of multiple driver genes, and each of them has corresponding solutions for targeted drugs. At the same time, many different types of Companion diagnostics kits have been developed in the market. In order to improve the accuracy of in vitro diagnostic kits, high-quality gDNAs extracted from point mutation cell lines are used as the raw material for quality control, which can not only simulate clinical samples, but also facilitate the development of diagnostic kits.

Why do you need high-quality gDNA?

High quality gDNA is the first step in the development of diagnostic kits and the basis for the deployment of different mutation frequencies. When the extracted gDNA contains impurities such as protein, RNA and organic matter, it will affect the stability and uniformity of gDNA, especially the determination of its concentration, which will greatly hinder the later research and production.
Cell line derived gDNA is the trend of quality control in IVD industry

Strict regulation of biomaterials makes it more difficult to obtain clinical samples for gene mutation diagnosis kit development. And there are many problems in using clinical samples as positive control for diagnosis kits, which makes gene mutation diagnosis kit manufacturers focus on cell lines carrying mutations.

Problems in using clinical samples as positive control:

Limited samples, non renewable

High heterogeneity, poor stability

Involving ethical issues and affected by laws and regulations

Rare mutation sites are difficult to obtain

Unable to accurately quantify, unclear copy number and allele number

The positive controls derived from cell lines have the following advantages:

Routine QC, better monitor the stability of the platform and manual operation, and eliminate background interference.

Better verify the sensitivity and specificity, and provide QC standard for the platform and process system.

Accurately define the threshold of each mutation.

As a quality control for R&D, it provides a stable quality control standard for the R&D process.
CRISPR/Cas9 gene editing cell lines can simulate clinical samples of any diseases

With the discovery of more and more essential mutation sites and the development of new targeted therapies, Common genetic mutations carried by cell lines are difficult to keep up with the current pace of innovation. In addition, for other indications, such as cardiovascular diseases, central nervous system diseases, inflammation, etc., it is difficult to find point mutations against these diseases from cell lines, because most of the cell lines are tumor cell lines, and few cell lines for these indications. What’s more, there are a large variety of cell lines, and it is not a low-cost and efficient way to undertake the process of purchase, culture, genome extraction for sequencing for every cell line. Moreover, it is very likely that the cell line carrying certain mutation cannot be found after verifying a large number of cell lines. Under this circumstance, using CRISPR/Cas9 technology to introduce disease mutation in cell line has become an important means to solve the problems and achieve simulation of clinical samples.

Ubigene products and services

Faster With the support of EZ-editor™ series products and Red Cotton™ point mutation strategy design system, the project progress is faster.

Higher With exclusive CRISPR-U™ technology combined with optimized gene-editing point mutation system, positive rate is higher.

Stronger With 12 years of gene editing experience and continuosly accumulated gene-editing experience based on thousands of success cases, Ubigene becomes stronger and stronger.

Companion Diagnostics

As an in vitro diagnostic technique, the companion diagnostics results can provide information about the treatment response of patients to specific therapeutic drugs, so as to determine the patient population that most likely to respond to the drug, which is helpful to formulate and adjust the treatment before and during the treatment, as well as improve the treatment prognosis and reduce the health care expenditure. At present, it has become trendy to carry out individualized treatment of tumors with the help of genetic diagnosis information obtained by companion diagnostics.

With more than 12 years of experience in cell line culture and gene editing, Ubigene can provide high-quality gDNA products and services to meet the needs of IVD kits development, quality control and registration.

Products (gDNA and cell lines)

High accuracy

Stable

Highly stimulate

Multiple applications

Gene	Mutated base	Mutated amino acid	Genotype
BRAF	c.1799T>A	p.V600E	Homozygote
EGFR	c.2235_2249del15	p.E746-A750del(1)	Heterozygote
	c.2369C> T	p.T790M	Heterozygote
	c.2155G>A	p.G719S	Heterozygote
	c.2303G>T	p.S768I	Homozygote
	c.2236_2250del15	p.E746-A750del(2)	Heterozygote
	c.2573T>G	p.L858R	Heterozygote
KRAS	c.34G>A	p.G12S	Homozygote
	c.35G>C	p.G12A	Homozygote
	c.38G>A	p.G13D	Heterozygote
	c.35G>A	p.G12D	Homozygote
	c.35G>T	p.G12V	Homozygote
	C.182A>T	p.Q61L	Heterozygote
	c.183A>T	p.Q61H	Homozygote
NRAS	c.35G>A	p.G12D	Heterozygote
	c.181C>A	p.Q61K	Heterozygote
	c.34G>T	p.G12C	Heterozygote
	c.34G>A	p.G12S	Heterozygote
	C.183A>T	p.Q61H	Heterozygote
	C.182A>T	p.Q61L	Heterozygote
PIK3CA	c.1633G>A	p.E545K	Heterozygote
	c.3140A>G	p.H1047R	Heterozygote
	c.1624G>A	p.E542K	Heterozygote

Services (Custom cell lines)

Stable

High purity

Multiple applications

Highly stimulate

Signature customize services

For rare tumor mutation sites or other indications, CRISPR-U™ technology can efficiently introduce target mutations into cell lines.

CRISPR-U™ is a gene editing technology independently developed by Ubigene which has higher gene cutting efficiency than ordinary CRISPR/Cas9 technology and can greatly improve the efficiency of homologous recombination, easily achieving gene knockout (KO), point mutation (PM) and knockin (KI) at the cellular and animal levels. Taking advantage of CRISPR-U™ technology, Ubigene has successfully achieved gene editing on more than 200 kinds of cell lines. Providing high-quality of experimental strategy and vector with the abundant experience of more than 200 cell lines and 5000 genes; Significantly increasing the transfection rate — thanks to the mature transfection system as well as the special transfection medium; Improving the single-cell clone formation rate by at least 30% with the great help of the single-cell clone culture medium; Easily realizing the batch validation of single-cell clones when growing in 96-well plate with the support of the single-cell clone validation kit. Ubigene comprehensively optimized all aspects of the gene-editing experiment to ensure the effective improvement of the success rate of gene-editing experiments and easy delivery of positive clones!

Mutation list

Drug metabolic enzymes and drug targets

The genetic variation and expression level of genes related to drug metabolism, transport and drug target can lead to individual differences in drug responsiveness by affecting the concentration and sensitivity of drugs in vivo. Pharmacogenomics has become an important tool for guiding clinical individualized drug use, assessing the risk of serious adverse drug reactions , guiding new drug development and evaluating new drugs. The detection of drug metabolic enzymes and drug targets can guide the clinical selection of appropriate drugs and dosages for specific patients, so as to achieve individualized medication, and thereby improve the effectiveness as well as the safety of drug treatment and prevent the occurrence of serious adverse drug reactions. At present, the US FDA and China's food and Drug Administration (CFDA) have approved a series of gene diagnostic kits for personalized drugs. In response to this trend, Ubigene have already launched services of drug metabolic enzymes and drug target cell line generation or gDNA customization.

Cardiovascular and cerebrovascular diseases

Gene	Mutation
CYP2C19	CYP2C19*2, Exon 5c.681G>A, SNP rs424428
CYP2C19	CYP2C19*3, Exon 4c.636G>A, SNP rs4986893
CYP2C19	CYP2C19*17, Promoter c.-806C>T, SNP rs12248560
ALDH2	Exon 12, Glu504Lys, SNP rs671
APOE	Exon 4, Cys130Arg, c.388T>C, SNP rs429358
APOE	Exon 4, Arg176Cys, c.526C>T, SNP rs7412
SLCO1B1	Exon 5, Asn130Aspc, 388 A>G, SNP rs2306283
SLCO1B1	Exon 6, Val174Ala, c.521 T>C, SNP rs4149056
CYP2C9*3	Ile359Leu, A1075C（NM_000771.4）
CYP2C9*2	Arg144Cys, C430T（NM_000771.4）
ADRB1	Gly389Arg（NM_000684.3:c.1165G>A/C）
ACE I/D	288bp Alu indel in Intron 16

If your gene is not included in the list, please contact us to evaluate the strategy. Talk to our expert

Arthritis

Gene	Mutation
CYP2C9*3	Ile359Leu, A1075C（NM_000771.4）
CYP2C9*2	Arg144Cys, C430T（NM_000771.4）
G6PD	1388G>A
G6PD	1376G>T
G6PD	1024C>T
G6PD	1004C>T
G6PD	871G>A
G6PD	95A>G

If your gene is not included in the list, please contact us to evaluate the strategy. Talk to our expert

Tumor

Gene	Mutation
CYP2D6*3	A2637 deletion
CYP2D6*4	G1934A
CYP2D6*5	CYP2D6 deletion
CYP2D6*10	Pro34Ser, C188T
DPYD*2A	Exon 14 1986 A>G（Splice Donor Variant, C>G/T）
TPMT*2	238G>C, Ala80Pro
TPMT*3A	460G>A, Ala154Thr
TPMT*3A	719A>G, Tyr240Cys
TPMT*3B	460G>A, Ala154Thr
TPMT*3C	719A>G, Tyr240Cys
UGT1A1*6	G71R, 211G>A
TOP2A	TOP2A gene amplification and gene deletion
G6PD	1388G>A
G6PD	1376G>T
G6PD	1024C>T
G6PD	1004C>T
G6PD	871G>A
G6PD	95A>G

If your gene is not included in the list, please contact us to evaluate the strategy. Talk to our expert

Others

Gene	Mutation	Disease
CYP3A5*3	c.22893 in intron 3 has 6986A>G	Autoimmune diseases
VKORC1	Promoter region-1639 G>A	Thromboembolic diseases
CYP4F2*3	C>T, V433M（NM_001082.5:c.1297G>A）	Thromboembolic diseases
NAT2	NM_000015.3:c.341T>A, p.Ile114Asn	Tuberculosis
NAT2	NM_000015.3:c.590G>A, p.Arg197Gln
NAT2	NM_000015.3:c.857G>A, p.Gly286Glu
NAT2	NM_000015.3:c.191G>A, p.Arg64Gln
ANKK1	c.2317G>A, Glu713Lys	Mental diseases
IFNL3	SNP C>T/G in 3kb upstream of IFNL3	Hepatitis C
G6PD	1388G>A	Malaria, skin diseases
G6PD	1376G>T
G6PD	1024C>T
G6PD	1004C>T
G6PD	871G>A
G6PD	95A>G
HLA-B	HLA-B1502, HLA-B5801, HLA-B*5701	Neurological diseases, hyperuricemia, AIDS

If your gene is not included in the list, please contact us to evaluate the strategy. Talk to our expert

Prenatal diagnosis

Prenatal screening and prenatal diagnosis are important means for eugenics. Through prenatal screening and prenatal diagnosis, we can assess the risk of fetal abnormalities and make clear diagnosis, and then choose appropriate measures to prevent the occurrence of serious birth defects. At present, the development of kits for prenatal screening and prenatal diagnosis is popular, greatly improving the universality of prenatal screening and prenatal diagnosis. In response to this trend, Ubigene launched point mutation cell lines or gDNA customized services related to two popular genetic diseases (epicophosis and thalassemia).

Featured custom service

Disease	Gene	Mutated loci
Epicophosis	GJB2	c.235delC
Epicophosis	GJB2	35 del G
Epicophosis	GJB2	c.35insG
Epicophosis	GJB2	167 del T
Epicophosis	GJB2	176-191del 16
Epicophosis	GJB2	299-300 del AT
Epicophosis	GJB3	c.538C>T
Epicophosis	GJB3	547G>A
Epicophosis	GJB3	494C>T
Epicophosis	GJB3	1555A>G
Epicophosis	SLC26A4	c.281C>T
Epicophosis	SLC26A4	c.589G > A
Epicophosis	SLC26A4	c.919-2A >G
Epicophosis	SLC26A4	c.1174A > T
Epicophosis	SLC26A4	c.1229C > T
Epicophosis	SLC26A4	c.1707+5 G>A
Epicophosis	SLC26A4	c.2027T > A
Epicophosis	SLC26A4	c.2168A > G
Epicophosis	SLC26A4	IVS7-2A>G
Epicophosis	SLC26A4	1226G>A
Epicophosis	SLC26A4	1975G>C
Epicophosis	SLC26A4	2162C>T
α-Thalassemia	HBA	（--SEA/）
α-Thalassemia	HBA	（-α4.2/）
α-Thalassemia	HBA	（-α3.7/）
α-Thalassemia	HBA	（--THAI/）
α-Thalassemia	HBA	WS122
α-Thalassemia	HBA	QS125
α-Thalassemia	HBA	CS142
β-Thalassemia	HBB	CD41-42(-CTTT)
β-Thalassemia	HBB	IVS-Ⅱ-654(C>T)
β-Thalassemia	HBB	CD17(AAG>TAG)
β-Thalassemia	HBB	-28（A>G)
β-Thalassemia	HBB	CD26(GAG>AAG)
β-Thalassemia	HBB	CD71-72(＋A)
β-Thalassemia	HBB	CD43(GAG>TAG)
β-Thalassemia	HBB	-29(A>G)
β-Thalassemia	HBB	Initiation codon (ATG>AGG)
β-Thalassemia	HBB	CD14-15(＋G)
β-Thalassemia	HBB	CD27/28(＋C)
β-Thalassemia	HBB	-32(C>A)
β-Thalassemia	HBB	-30(T>C)
β-Thalassemia	HBB	IVS-Ⅰ-1(G>T)
β-Thalassemia	HBB	IVS-Ⅰ-5 (G>C)
β-Thalassemia	HBB	CD31(-C)
β-Thalassemia	HBB	5′UTR Cap＋40-43-42(-AAAC)

Advantages of Ubigene's point mutation editing

01 Exclusive Red Cotton point mutation strategy designer, automatically offers at least 2 strategies in 1 minute.
02 Master four techniques (RNP method/plasmid antibiotic selection method/BE system/AAV-donor method) to deal with various mutation issues.
03 Fully optimized production system joins hands with the exclusive data analysis system and innovative products to significantly improve the screening efficiency of positive clones and shorten the project turnaround.

The c.G2149T point mutation of APP gene was carried out in iPSC by RNP method. After transfection, the recombination efficiency of the cell pool was detected. According to Sanger sequencing results, it can be seen that gRNA has a significant cleavage effect (Fig. 1). According to the analysis result by EZ-editorTM Genotyoe Analysis System (GAS), the homologous recombination genotype accounted for 14% (Fig. 2), which indicated that the efficiency was high, so single-cell clone isolation was next carried out.

Fig. 1 Sanger sequencing of cell pool

Fig. 2 EZ editorTM Genotyoe Analysis System (GAS) result

p.R140W mutation of IDH2 gene was carried out in THP-1 cell line by AAV-Donor method. After transfection, the recombination efficiency of the cell pool was detected. According to Sanger sequencing results, it can be seen that gRNA has a significant cleavage effect (Fig. 3). According to the analysis result by EZ-editorTM Genotyoe Analysis System (GAS), the homologous recombination genotype accounted for 23% (Fig. 4), which indicated that the efficiency was high, so single-cell clone isolation was next carried out. In the single-cell clone validation process, two mutant homozygotes were obtained. (Fig. 5)

Fig. 3 Sanger sequencing of cell pool

Fig. 4 EZ editorTM Genotyoe Analysis System (GAS) result

Fig. 5 Two mutant homozygotes genotype alignment result

AGTTCAAGCTGAAGAAGATGTGGAAAAGTCCCAATGGAACTATC(C→T)GGAACATCCT(G→C)GGGGGGACTGTCTTCCGGGAGCCCATCATCTGCAAAAACATCCCACGCCTAGTCCCTGGCTGGACCAAGCCCATCACCATTGGCAGGCACGCCCATGGCGACCAG

Red characters (C→T) indicate the target mutation site p.R140W (CGG > TGG).
Blue characters (G→C) indicate the silent mutation site (CTG>CTC).
File PK21115-02-A01-PK1344 is the Sanger sequencing result of E8 clone.
File PK21115-02-A03-PK1344 is the Sanger sequencing result of H3 clone.

Ubigene products and services

Companion Diagnostics

Products (gDNA and cell lines)

Services (Custom cell lines)

Mutation list

Drug metabolic enzymes and drug targets

Prenatal diagnosis

Featured custom service

Advantages of Ubigene's point mutation editing

Gene Editing Services

EZ-editor™ Products

Contact us✖

Contact us