Red Cotton™ gRNA Plasmid Bank | Ubigene

location: Home > Products >
All products
  • All products
  • Red Cotton™ gRNA Plasmid Bank
  • KO Cell Lines
  • Wild-type Cell Lines
  • Cas9 Stable Cell Lines
  • Luciferase Stable Cell Lines
  • EGFP Stable Cell Lines
  • Stem Cell Lines
  • Transfection Culture Medium
  • Cell Monoclonal Culture Medium
  • EZ-Stem Cell Culture Medium
  • Kits
  • Lentivirus

Red Cotton™ gRNA Plasmid Bank

Based on our CRISPR-U™ Technology and thousands of gene-editing success cases, Ubigene has successfully developed a series of gRNA plasmids (YKO) with high gene-editing efficiency, including regular plasmids, lentiviral plasmids, and AAV plasmids. And Ubigene has successfully established the Red Cotton™ gRNA Plasmid Bank, which is the basis of our “Red Cotton Gene Knockout Project”. Ubigene's plasmids can enter cells via regular transfection methods and can edit target sites efficiently after transient expression of high levels of Cas9 protein in target cells. Also, our plasmids can be co-transfected with a variety of gRNAs to target multiple sites in cells. At present, our Red Cotton™ gRNA Plasmid Bank has over 10000 gRNA plasmids in stock, which can be widely used in different fields of gene-editing research. You can search our in-stock gRNA plasmids according to your gene of interest.

Gene ID Size Price (USD) Turnaround Resistance Instruction Product Name Type of Plasmid Catalog# gRNA Sequence
   10166 ≥2ug 80 3-5(business day) EGFP/puro/cas9
hSLC25A15 gRNA1 KO plasmid
hSLC25A15 gRNA2 KO plasmid
hSLC25A15 gRNA3 KO plasmid
Regular Plasmid YKO-RP003-hSLC25A15[gRNA1]
YKO-RP003-hSLC25A15[gRNA2]
YKO-RP003-hSLC25A15[gRNA3]
AGTCGGTGAGGCCCCGGTACAGG(93,0.83)
GTACAGCATGTGTACTGACCGGG(82,0.7)
CCTGAAGACTTACTCCCAGGTGG(75,0.73)
   10174 ≥2ug 80 3-5(business day) EGFP/puro/cas9
hSORBS3 gRNA1 KO plasmid
hSORBS3 gRNA2 KO plasmid
hSORBS3 gRNA3 KO plasmid
Regular Plasmid YKO-RP003-hSORBS3[gRNA1]
YKO-RP003-hSORBS3[gRNA2]
YKO-RP003-hSORBS3[gRNA3]
ACATAGGGTCTTCCTCCCGGGGG(88,0.74)
AGCCTGGACGACTTCATCCCTGG(80,0.76)
CACCCCGCAGCCTCCGCGCTGGG(79,0.65)
   1018 ≥2ug 80 3-5(business day) EGFP/puro/cas9
hCDK3 gRNA1 KO plasmid
hCDK3 gRNA2 KO plasmid
hCDK3 gRNA3 KO plasmid
Regular Plasmid YKO-RP003-hCDK3[gRNA1]
YKO-RP003-hCDK3[gRNA2]
YKO-RP003-hCDK3[gRNA3]
AGATCGGAGAGGGCACCTAT GGG(86,0.65)
GGCCCTGAAGAAGATCAGAC TGG(76,0.64)
CAGGGAGATCTCGCTGCTCA AGG(78,0.74)
   10188 ≥2ug 80 3-5(business day) EGFP/puro/cas9
hTNK2 gRNA1 KO plasmid
hTNK2 gRNA2 KO plasmid
hTNK2 gRNA3 KO plasmid
Regular Plasmid YKO-RP003-hTNK2[gRNA1]
YKO-RP003-hTNK2[gRNA2]
YKO-RP003-hTNK2[gRNA3]
GACCTGGAGAAGATCGGCATGGG(93,0.78)
TGACGTACTCAAAGTGGGACAGG(89,0.66)
AGCTGCAACAGTACTTCCTGCGG(70,0.73)
   1019 ≥2ug 80 3-5(business day) EGFP/puro/cas9
hCDK4 gRNA1 KO plasmid
hCDK4 gRNA2 KO plasmid
hCDK4 gRNA3 KO plasmid
Regular Plasmid YKO-RP003-hCDK4[gRNA1]
YKO-RP003-hCDK4[gRNA2]
YKO-RP003-hCDK4[gRNA3]
GAAATTGGTGTCGGTGCCTA TGG(92,0.65)
CATCAGCACAGTTCGTGAGG TGG(90,0.74)
TACCTCTCGATATGAGCCAG TGG(88,0.66)
   10193 ≥2ug 80 3-5(business day) EGFP/puro/cas9
hRNF41 gRNA1 KO plasmid
hRNF41 gRNA2 KO plasmid
hRNF41 gRNA3 KO plasmid
Regular Plasmid YKO-RP003-hRNF41[gRNA1]
YKO-RP003-hRNF41[gRNA2]
YKO-RP003-hRNF41[gRNA3]
GGGCGACCGTCACAACACTACGG(96,0.7)
GCAACGCCTGCATCACCCAGTGG(79,0.71)
TCAGCAACAGACATGTCCAGTGG(60,0.76)
   10196 ≥2ug 80 3-5(business day) EGFP/puro/cas9
hPRMT3 gRNA1 KO plasmid
hPRMT3 gRNA2 KO plasmid
Regular Plasmid YKO-RP003-hPRMT3[gRNA1]
YKO-RP003-hPRMT3[gRNA2]
GGGGGTCTGCTGCTTGCCGTGGG(87,0.78)
CGCTGTCCGACAGTTCTGGCAGG(86,0.67)
   102 ≥2ug 80 3-5(business day) EGFP/puro/cas9
hADAM10 gRNA1 KO plasmid
hADAM10 gRNA2 KO plasmid
Regular Plasmid YKO-RP003-hADAM10[gRNA1]
YKO-RP003-hADAM10[gRNA2]
AGACTGCTCTTTTGGCACGCTGG(94,0.7)
CGTCTAGATTTCCATGCCCATGG(85,0.75)
   1020 ≥2ug 80 3-5(business day) EGFP/puro/cas9
hCDK5 gRNA1 KO plasmid
hCDK5 gRNA2 KO plasmid
hCDK5 gRNA3 KO plasmid
Regular Plasmid YKO-RP003-hCDK5[gRNA1]
YKO-RP003-hCDK5[gRNA2]
YKO-RP003-hCDK5[gRNA3]
CCGGGAGACTCATGAGATCGTGG(87,0.67)
GGCCTTGAACACAGTTCCGTAGG(89,0.64)
GTGTGCCGAGTTCCGCCCTCCGG(82,0.69)
   1021 ≥2ug 80 3-5(business day) EGFP/puro/cas9
hCDK6 gRNA1 KO plasmid
hCDK6 gRNA2 KO plasmid
hCDK6 gRNA3 KO plasmid
Regular Plasmid YKO-RP003-hCDK6[gRNA1]
YKO-RP003-hCDK6[gRNA2]
YKO-RP003-hCDK6[gRNA3]
GCCCGCGACTTGAAGAACGG AGG(96,73)
CCAGCAGTACGAATGCGTGG CGG(94,73)
GCCGCTCTCCACCATCCGCG AGG(87,66)

Contact us